[ad_1]
Tumor cell-derived exosomes induced M2 polarization of macrophages, which subsequently promoted the proliferation and migration of tumor cells
Exosomes are essential mediators of intercellular communication within the TME. 4T1 cell-derived exosomes (T-exo) was extracted, and the characterization of exosomes was confirmed. The particle analyzer revealed that the particle measurement of the extracted exosomes was 75.9 ± 3.56 nm with the everyday cup-shaped morphology confirmed by transmission electron microscopy (TEM) (Further file 1: Fig. S1a, b). The outcomes of western blot (Further file 1: Fig. S1c) confirmed that the exosomes extremely expressed CD63, a recognized exosomal marker, whereas the expression of CD63 within the corresponding cell lysate was low.
To find out whether or not T-exo may induce M2 polarization of macrophages, macrophages have been handled with T-exo and the expression of acknowledged macrophage marker CD206 (Fig. 1a) and secreted IL-10 in macrophage-conditioned medium (MCM) (Fig. 1b) was detected by stream cytometry (FCM) and enzyme-linked immunosorbent assay (ELISA), respectively. The outcomes confirmed that the expression ranges of CD206 and IL-10 have been extremely elevated in macrophages handled with T-exo. In the meantime, we puzzled whether or not the oncogene c-Myc would possibly affect this course of. Because of the insolubility and systemic toxicity of c-Myc inhibitor JQ1, we beforehand designed and ready JQ1-loaded nanoparticles (Ex 26-CSOPOSA/JQ1), which possessed S1PR1-targeting and ROS-sensitive launch traits, to enhance the perform of JQ1. After pretreatment with JQ1 or Ex 26-CSOPOSA/JQ1, we discovered that the expression of CD206 and IL-10 induced by T-exo stimulation was considerably down-regulated. And in contrast with free JQ1, Ex 26-CSOPOSA/JQ1 exhibited a stronger inhibitory impact. Observing the morphological adjustments of macrophages on this course of (Further file 1: Fig. S2), it may very well be seen that the macrophages co-incubated with T-exo confirmed a protracted spindle sort, which was a typical M2 polarization type. JQ1 and Ex 26-CSOPOSA/JQ1 pretreatment may keep the sphericity of macrophages.
Moreover, we investigated the function of T-exo-polarized macrophages in tumor cell proliferation and migration. After 4T1 cells have been cultured with totally different MCM for twenty-four h, the outcomes of MTT assay (Fig. 1c) confirmed that the conditioned medium from T-exo-treated macrophages (MCM (T-exo)) considerably promoted the proliferation of 4T1 cells, whereas the pretreatment of JQ1 and Ex 26-CSOPOSA/JQ1 may successfully inhibit this selling impact. The transwell assay evaluated the migration of 4T1 cells induced by totally different conditioned macrophages and confirmed the identical development (Fig. 1d, e).
T-exo promoted tumor development by inducing M2 macrophage polarization, which was blocked by Ex 26-CSOPOSA/JQ1. FCM for CD206 ranges (a) and ELISA for the secretion of IL-10 (b) of T-exo-stimulated macrophages with or with out the pretreatment of JQ1 or Ex 26-CSOPOSA/JQ1 (n = 3). c The proliferation of 4T1 cells cultured with MCM from macrophages handled as described above assessed by MTT assay (n = 3). Consultant pictures of transwell migration assay (d) and the relative migration cell quantity (e) of 4T1 cells co-cultured with M0 macrophages (4T1-co-M0) handled as described above (n = 3). Tumor quantity adjustments (f), picture of tumors (g) and tumor weight (h) of every group (n = 5). i The expression of Cd206 in tumor tissues detected by qRT-PCR (n = 3). The fluorescence depth of PKH67 measured by FCM (j) and fluorescence spectrophotometry (okay) in macrophages after incubated with PKH67-labelled T-exo with or with out the pretreatment of JQ1 or Ex 26-CSOPOSA/JQ1 (n = 3). The uptake mechanism of PKH67-labelled T-exo by macrophages examined by FCM (l) and fluorescence spectrophotometry (m) by pretreating cells with inhibitors of various internalization pathways. n The degrees of Rac1 in macrophages decided by IF staining. Cell nuclei have been blue. Rac1 was purple. o MFI of Rac1 in (n) calculated by ImageJ software program (n = 3). Knowledge have been expressed as imply ± SD (*p < 0.05, **p < 0.01, ***p < 0.001)
To additional examine the tumor-promoting impact of polarized macrophages in vivo, 4T1 cells combined with M0 macrophages (4T1 + M0) or T-exo-polarized macrophages pre-treated with or with out JQ1 or Ex 26-CSOPOSA/JQ1 have been in situ inoculated into Balb/c mice. The tumor development curve and tumor weight on the final day (Fig. 1f-h) have been measured, and the expression of Cd206 in tumor tissues (Fig. 1i) was measured by quantitative real-time PCR (qRT-PCR). In keeping with the earlier outcomes, 4T1 cells combined with T-exo-polarized macrophages generated bigger and heavier tumors with excessive expression of Cd206. Pretreating macrophages with JQ1 or Ex 26-CSOPOSA/JQ1 may gradual the tumor development and down-regulate the expression of Cd206. Collectively, these outcomes demonstrated that T-exo may induce M2 polarization of macrophages to speed up tumor development, and Ex 26-CSOPOSA/JQ1 may inhibit the tumor-promoting impact of T-exo by interfering with the polarization course of.
Ex 26-CSOPOSA/JQ1 decreased the uptake of tumor cell-derived exosomes by macrophages by down-regulating the expression of Rac1
To discover the mechanism by which Ex 26-CSOPOSA/JQ1 interfered with T-exo-induced macrophage polarization, we centered on the impact of Ex 26-CSOPOSA/JQ1 on exosome uptake by macrophages. Macrophages have been incubated with PKH67-labelled exosomes for two h, and the fluorescence depth of PKH67 was measured by FCM (Fig. 1j) and fluorescence spectrophotometry (Fig. 1okay). In contrast with the management group, after incubating JQ1 or Ex 26-CSOPOSA/JQ1 with cells for twenty-four h, the imply fluorescence depth (MFI) of PKH67 was considerably decreased, indicating that the uptake of exosomes by macrophages was considerably inhibited.
Due to this fact, we additional investigated the mechanism of exosome uptake. Nystatin, Chlorpromazine and Cytochalasin D have been used as particular inhibitors of Caveolin-mediated endocytosis, Clathrin-mediated endocytosis and micropinocytosis, respectively. The outcomes detected by FCM (Fig. 1l) and fluorescence spectrophotometry (Fig. 1m) confirmed that the uptake of T-exo by macrophages was primarily inhibited by Cytochalasin D, indicating that it was primarily via macropinocytosis pathway, Due to this fact, we hypothesized that Rac1, a key protein within the macropinocytosis pathway [24, 25], may be a key molecule by which JQ1 and Ex 26-CSOPOSA/JQ1 inhibited the exosome uptake. Then, immunofluorescence (IF) staining was carried out to find out the expression of Rac1 on macrophages, and the outcomes confirmed that JQ1 and Ex 26-CSOPOSA/JQ1 considerably down-regulated the expression degree of Rac1 (Fig. 1n, o). All these outcomes advised that Ex 26-CSOPOSA/JQ1 decreased the uptake of T-exo by macrophages by down-regulating the expression of Rac1, thereby interfering with T-exo-induced M2 polarization of macrophages.
MiR-184-3p enriched in tumor cell-derived exosomes was delivered to macrophages to induce M2 polarization of macrophages and promote tumor development
MiRNAs have been reported to be necessary cargos, which could be sorted into exosomes and delivered to focus on cells, thereby reprogramming the phenotype of goal cells. With the intention to make clear whether or not miRNAs play a key function within the M2 polarization course of, miRNA sequencing (miRNA-seq) of two batches of T-exo and macrophages handled with or with out T-exo was carried out to research the miRNA profiles in T-exo and the differentially expressed miRNAs in macrophages below totally different remedies. Among the many miRNAs recognized, 140 overlapping miRNAs have been recognized and confirmed in two batches of T-exo (Fig. 2a), and we centered on the highest 10 extremely expressed miRNAs (Fig. 2b). In comparison with M0 macrophages, 174 miRNAs have been up-regulated and 101 miRNAs have been down-regulated in T-exo-treated M0 macrophages (M0-T-exo) (Fig. 2c). We additional screened the up-regulated miRNAs with excessive and center expression and located that miR-184-3p extremely expressed in T-exo was considerably up-regulated in M0-T-exo (Fig. 2d).
MiR-184-3p enriched in T-exo was delivered to macrophages to advertise tumor development. a Venn diagram confirmed the overlap of miRNAs in two batches of T-exo detected by miRNA-seq. b Heatmap of the highest 10 extremely expressed miRNAs in (a). c Volcano of differentially expressed miRNAs in macrophages handled with or with out T-exo detected by miRNA-seq. d Heatmap of the up-regulated miRNAs with excessive and center expression in (c). e The expression of miR-184-3p in macrophages and T-exo detected by qRT-PCR (n = 3). CD206 ranges (f) and secreted IL-10 (g) of macrophages transfected with destructive management (N.C.) or miR-184-3p mimics (n = 3). h The proliferation of 4T1 cells cultured with MCM from macrophages handled as described above assessed by MTT assay (n = 3). Consultant pictures of transwell migration assay (i) and the relative migration cell quantity (j) of 4T1 cells co-cultured with macrophages handled as described above (n = 3). Tumor quantity adjustments (okay), picture of tumors (l) and tumor weight (m) of every group (n = 5). n The expression of Cd206 in tumor tissues detected by qRT-PCR (n = 3). Knowledge have been expressed as imply ± SD (**p < 0.01, ***p < 0.001)
In keeping with this discovering, excessive expression of miR-184-3p was detected in T-exo and M0-T-exo by qRT-PCR in contrast with M0 macrophages (Fig. 2e), indicating that miR-184-3p may very well be delivered to macrophages by way of T-exo. As well as, pretreatment with JQ1 or Ex 26-CSOPOSA/JQ1 may cut back the expression of miR-184-3p up-regulated by T-exo in macrophages (Further file 1: Fig. S3). Due to this fact, we sought to find out whether or not miR-184-3p was the important thing molecule in T-exo-induced M2 polarization of macrophages. After transfection with miR-184-3p mimics to up-regulate the expression of miR-184-3p in macrophages (Further file 1: Fig. S4), it was discovered that M2 macrophage markers, together with CD206 and IL-10, have been considerably induced to extend (Fig. 2f, g). Moreover, MCM and corresponding transfected macrophages have been collected for MTT assay (Fig. 2h) and transwell assay (Fig. 2i, j) described above to judge the impact on proliferation and migration of tumor cells. Apparently, each the proliferation and migration skills of 4T1 cells have been considerably elevated by macrophages transfected with miR-184-3p mimics.
We additional validated the perform of miR-184-3p in vivo by inoculating 4T1 cells combined with macrophages transfected with miR-184-3p mimics or destructive management (N.C.) into Balb/c mice. The tumor quantity and tumor weight have been measured (Fig. 2k-m), and the expression of Cd206 in tumor tissues was measured by qRT-PCR (Fig. 2n). The outcomes confirmed that mice in 4T1 + M0 (miR-184-3p mimics) group bore with bigger and heavier tumors infiltrated with extra M2 macrophages. Altogether, these outcomes demonstrated that miR-184-3p was enriched in T-exo, which may very well be delivered to macrophages by way of exosomes to induce M2 polarization of macrophages, thereby selling tumor cells proliferation and migration.
Exosomal miR-184-3p induced M2 polarization of macrophages by way of down-regulating EGR1 expression and inhibiting the JNK signaling pathway
To deeply discover the mechanism of exosomal miR-184-3p within the induction of macrophage polarization, mRNA sequencing (mRNA-seq) evaluation was carried out to find out the differentially expressed mRNAs in M0 macrophages and M0-T-exo, and the potential miR-184-3p targets have been predicted by the net bioinformatic device ENCORI. M0 macrophages have been used as management to display screen down-regulated genes in M0-T-exo, and mixed with the anticipated goal gene profile of miR-184-3p, a complete of 21 overlapping genes have been screened out (Fig. 3a). With the fragments per kilobase of exon mannequin per million mapped reads (FPKM) worth higher than 10 as the usual, 12 potential regulatory molecules have been additional screened out (Fig. 3b). Combining the expression degree and the distinction in expression between the 2 teams, we centered on Egr1 gene. Extra importantly, EGR1 protein has been reported to activate the JNK signaling pathway, a key signaling pathway that regulates macrophage polarization [26, 27]. Due to this fact, we concluded that overexpression of miR-184-3p in M0-T-exo inhibited JNK signaling pathway by down-regulating the expression of EGR1, thus selling M2 polarization of macrophages.
Exosomal miR-184-3p induced M2 macrophage polarization by inhibiting EGR1 expression and JNK signaling pathway. a Venn diagram confirmed the overlap of mRNAs in down-regulated genes in M0-T-exo detected by mRNA-seq and the anticipated goal genes of miR-184-3p. b Heatmap of 12 mRNAs screened from (a). c The expression of Egr1 gene in M0-T-exo and M0 macrophages detected by qRT-PCR. d The expression of EGR1 protein in M0-T-exo and M0 macrophages decided by IF staining. Cell nuclei have been blue. Rac1 was purple. e MFI of Rac1 in (d) calculated by ImageJ software program. f The expression of Egr1 gene in macrophages transfected with N.C. or miR-184-3p mimics detected by qRT-PCR. g The expression of EGR1 protein in macrophages transfected with N.C. or miR-184-3p mimics decided by IF staining. Cell nuclei have been blue. Rac1 was purple. h MFI of Rac1 in (g) calculated by ImageJ software program. Western blot assays for p-JNK expression in M0-T-exo (i) and macrophages transfected with miR-184-3p mimics (j). Knowledge have been expressed as imply ± SD (n = 3, ***p < 0.001)
To substantiate the anticipated regulatory mechanism, the expression of associated genes and proteins have been decided. In contrast with M0 macrophages, the expression of Egr1 gene and EGR1 protein in M0-T-exo detected by qRT-PCR (Fig. 3c) and IF staining (Fig. 3d, e) was considerably down-regulated. The identical development was additionally noticed in macrophages transfected with miR-184-3p mimics (Fig. 3f-h). Accordingly, the expression of phospho-JNK (p-JNK) in M0-T-exo (Fig. 3i) and macrophages transfected with miR-184-3p mimics (Fig. 3j) measured by western blot was inhibited. The outcomes of semi-quantitative evaluation of western blot additionally confirmed this level (Further file 1: Fig. S5). In sum, miR-184-3p in macrophages transferred by T-exo may inhibit the JNK signaling pathway by focusing on EGR1, thereby inducing M2 polarization of macrophages.
MiR-184-3p functioned as a Tumor suppressor by down-regulating MAML1
The miRNA profiles of mother or father cells and their derived exosomes are sometimes totally different. The expression of miR-184-3p in 4T1 and T-exo was measured by qRT-PCR, and we have been shocked to seek out that though miR-184-3p was extremely expressed in T-exo, the expression in 4T1 cells was very low (Fig. 4a). Mixed with the earlier findings, we speculated that miR-184-3p served as a tumor suppressor in 4T1 cells, which may very well be actively secreted out via exosomes. To analyze the function of miR-184-3p in 4T1 cells, we up-regulated or down-regulated the expression of miR-184-3p by transfecting miR-184-3p mimics (Further file 1: Fig. S6a) or miR-184-3p inhibitors (Further file 1: Fig. S6b), respectively. The proliferation capacity of 4T1 cells was measured by MTT assay at totally different time factors, and the outcomes (Fig. 4b) confirmed that the extremely expressed miR-184-3p may successfully inhibit the proliferation of tumor cells. In the meantime, the outcomes of the wound-healing assay confirmed that the migration capacity of 4T1 cells was additionally inhibited by the overexpression of miR-184-3p (Fig. 4c, d).
In vivo outcomes additional confirmed the earlier findings, as the extent of miR-184-3p was considerably decrease in tumor tissues than in regular mammary glands and have been negatively correlated with tumor measurement (Fig. 4e). What’s extra, the expression of miR-184-3p of the tumor tissues excised from the mice implanted with 4T1 cells combined with conditioned macrophages performed above was evaluated by qRT-PCR (Further file 1: Fig. S7a, b). The bigger tumors generated by 4T1 cells combined with T-exo-polarized macrophages or miR-184-3p mimics-transfected macrophages had extraordinarily low expression of miR-184-3p. Pretreating macrophages with JQ1 or Ex 26-CSOPOSA/JQ1 may rescue the expression of miR-184-3p.
MiR-184-3p functioned as a tumor suppressor by down-regulating MAML1. a The expression of miR-184-3p in M0 macrophages, 4T1 cells and T-exo detected by qRT-PCR. b The proliferation of 4T1 cells transfected with N.C. or miR-184-3p mimics decided by MTT assay at totally different time factors. Consultant pictures of the wound-healing assay (c) and wound-healing proportion (d) of 4T1 cells transfected with N.C. or miR-184-3p mimics. e The expression of miR-184-3p in mammary glands and tumors of various sizes measured by qRT-PCR. The gene expression of Maml1 in 4T1 cells transfected with miR-184-3p mimics (f) or miR-184-3p inhibitors (g) decided by qRT-PCR. The protein ranges of MAML1 in 4T1 cells transfected with miR-184-3p mimics (h) or miR-184-3p inhibitors (j) decided by IF staining. Cell nuclei have been blue. MAML1 was purple. i MFI of MAML1 in (h) calculated by ImageJ software program. okay MFI of MAML1 in (j) calculated by ImageJ software program. Knowledge have been expressed as imply ± SD (n = 3, **p < 0.01, ***p < 0.001)
With the intention to discover the molecular mechanism, we centered on Maml1, a possible goal of miR-184-3p with strict stringency predicted by ENCORI. Extra importantly, MAML1, as a significant transcriptional co-activator for Notch signaling, prompts a number of signaling pathways which might be dysregulated in tumor cells, together with p53, NF-κB, and Wnt/β-catenin, to advertise tumor growth [28,29,30,31]. Due to this fact, the gene expression of Maml1 and the protein ranges of MAML1 in 4T1 cells transfected with miR-184-3p mimics or miR-184-3p inhibitors have been decided respectively by qRT-PCR (Fig. 4f, g) and IF staining (Fig. 4h-k). The outcomes confirmed that the gene expression of Maml1 and the protein ranges of MAML1 in 4T1 cells have been decreased after transfection with miR-184-3p mimics and elevated after transfection with miR-184-3p inhibitors. All these outcomes indicated that miR-184-3p functioned as a tumor suppressor in TNBCs by focusing on MAML1.
HnRNPA2B1 immediately mediated mir-184-3p packaging into Tumor cell-derived exosomes
A co-culture assay was carried out to find out whether or not miR-184-3p was primarily secreted by exosomes. The expression of miR-184-3p in macrophages co-cultured with 4T1 cells pre-treated with or with out the exosome secretion inhibitor GW4869 was evaluated by qRT-PCR (Fig. 5a). In contrast with M0 macrophages, the expression of miR-184-3p in M0 macrophages co-cultured with 4T1 cells (M0-co-4T1) was considerably elevated. The pretreatment of GW4869 considerably lowered the supply of miR-184-3p to M0 macrophages, and the expression of miR-184-3p in M0 macrophages co-cultured with 4T1 cells pre-treated with GW4869 (M0-co-4T1 (GW4869)) was much like that in M0 macrophages. This outcome indicated that miR-184-3p was primarily delivered via exosomes.
Since miRNAs could be selectively sorted into exosomes via purposeful quite than passive processes, we explored the molecular mechanism that managed the sorting of miR-184-3p into exosomes. RNA-binding proteins (RBPs) are a category of key molecules that contribute to the sorting course of by recognizing particular motifs on miRNAs [32]. Primarily based on the sequence of miR-184-3p, we centered on the RNA-binding protein hnRNPA2B1, because it has been proven to particularly bind to GGAG and AGG motifs [22, 33], each of that are included within the miR-184-3p sequence (UGGACGGAGAACUGAUAAGGGU). Particular binding of hnRNPA2B1 to miR-184-3p was verified by RNA immunoprecipitation (RIP) of hnRNPA2B1 from 4T1 cell lysates (Fig. 5b). The outcomes confirmed that miR-184-3p detected by qRT-PCR was primarily amplified from hnRNPA2B1 polyclonal antibody (anti-hnRNPA2B1) immunoprecipitates quite than immunoglobulin G (IgG) immunoprecipitates, demonstrating particular binding of hnRNPA2B1 and miR-184-3p in cells.
HnRNPA2B1 immediately mediated miR-184-3p packaging into tumor cell-derived exosomes. a The expression of miR-184-3p in macrophages co-cultured with 4T1 cells pre-treated with or with out GW4869 by qRT-PCR (n = 3). b RIP evaluation of miR-184-3p sure by hnRNPA2B1 by incubating 4T1 cell lysates with IgG or anti-hnRNPA2B1 (n = 3). Intracellular (c) and exosomal (d) ranges of miR-184-3p in 4T1 cells transfected with N.C. or si-hnRNPA2B1 (n = 3). e The proliferation of 4T1 cells transfected with N.C. or si-hnRNPA2B1 decided by MTT assay at totally different time factors (n = 3). The expression of miR-184-3p (f) and Cd206(g) in macrophages co-cultured with 4T1 cells transfected with N.C. or si-hnRNPA2B1 by qRT-PCR (n = 3). h ELISA for the secreted IL-10 in MCM (n = 3). Picture of tumors (i), tumor quantity adjustments (j), and tumor weight (okay) of every group (n = 5). l H&E staining for livers and lungs from tumor-bearing mice. Tumor metastases have been marked by yellow strains. The expression of miR-184-3p (m) and Cd206(n) in tumor tissues detected by qRT-PCR (n = 3). o ELISA for the secreted IL-10 in plasma from tumor-bearing mice (n = 3). Knowledge have been expressed as imply ± SD (*p < 0.05, **p < 0.01, ***p < 0.001)
We additional evaluated the impact of hnRNPA2B1 knockdown (Further file 1: Fig. S8) on miR-184-3p sorting into exosomes. After hnRNPA2B1 knockdown in 4T1 cells transfected with hnRNPA2B1 siRNA (si-hnRNPA2B1), miR-184-3p elevated considerably in cells however decreased in exosomes (Fig. 5c, d). In keeping with the beforehand found perform of miR-184-3p, the knockdown of hnRNPA2B1 successfully inhibited the proliferation of 4T1 cells by rising intracellular miR-184-3p (Fig. 5e). Correspondingly, M0 macrophages co-cultured with 4T1 cells with low hnRNPA2B1 expression obtained much less miR-184-3p from T-exo (Fig. 5f), thereby the M2 polarization course of was blocked, as Cd206 and secreted IL-10 have been considerably decreased (Fig. 5g, h).
The function of miR-184-3p and hnRNPA2B1 in tumor development and metastasis was additional assessed in vivo. The amount of tumors generated by 4T1 cells transfected with totally different lentivirus and eventual tumor weight have been monitored (Fig. 5i-k). The overexpression of miR-184-3p (miR-184-3p OE) or knockdown of hnRNPA2B1 (hnRNPA2B1 KD) may inhibit the expansion of tumors to a sure extent, and the smallest and lightest tumors have been current within the miR-184-3p OE & hnRNPA2B1 KD group. H&E staining was carried out to noticed the tumor metastases (marked by yellow strains) within the livers and lungs (Fig. 5l). In contrast with the N.C. group, fewer metastases have been noticed within the miR-184-3p OE group and hnRNPA2B1 KD group, and extra importantly, no metastasis occurred within the miR-184-3p OE & hnRNPA2B1 KD group. What’s extra, elevated expression of miR-184-3p (Fig. 5m) and decreased expression of Cd206 (Fig. 5n) in tumor tissues within the miR-184-3p OE & hnRNPA2B1 KD group have been confirmed by qRT-PCR, and the secretion of IL-10 detected by ELISA was additionally considerably decreased (Fig. 5o). All these outcomes indicated that hnRNPA2B1 performed an necessary function within the sorting of tumor suppressor miR-184-3p into exosomes, and blocking this course of may successfully inhibit tumor development and metastasis.
[ad_2]
